Archives
Influenza Hemagglutinin (HA) Peptide: Precision Tag for P...
Influenza Hemagglutinin (HA) Peptide: Revolutionizing Precision in Protein Tagging and Interaction Studies
Principle and Setup: Harnessing the Power of the HA Tag Peptide
The Influenza Hemagglutinin (HA) Peptide (sequence: YPYDVPDYA) is a synthetic, nine-amino acid epitope tag derived from the influenza virus hemagglutinin protein. Valued for its compact size, immunogenicity, and high specificity, the HA tag peptide is extensively deployed in molecular biology for the detection, purification, and study of HA-tagged fusion proteins. Its competitive binding capability to anti-HA antibodies enables efficient elution during immunoprecipitation (IP) and co-immunoprecipitation (co-IP) assays, as well as streamlined protein purification workflows.
The Influenza Hemagglutinin (HA) Peptide (SKU: A6004) stands out due to its high purity (>98% by HPLC/MS) and remarkable solubility—over 100 mg/mL in ethanol, 55 mg/mL in DMSO, and 46 mg/mL in water. This versatility supports seamless integration into diverse experimental buffers and conditions, making it a preferred protein purification tag in high-demand workflows. Its epitope sequence is universally recognized by anti-HA antibodies, facilitating reproducible detection, competitive elution, and downstream analyses.
Step-by-Step Workflow: Protocol Enhancements with HA Tag Peptide
1. Expression and Detection of HA-Tagged Fusion Proteins
- Cloning and Transfection: Design primers to add the HA tag DNA sequence (TACCCATACGATGTTCCAGATTACGCT) to the gene of interest. Verify insert orientation and expression using PCR and Western blot with anti-HA antibody.
- Protein Expression: Transfect mammalian, yeast, or bacterial cells. The compact size of the HA tag minimizes interference with protein folding and activity.
- Detection and Analysis: Utilize anti-HA antibodies in Western blot, immunofluorescence, or ELISA formats to confirm expression and localization. The high-affinity interaction between the HA epitope and antibody ensures low background and high sensitivity.
2. Immunoprecipitation and Purification: Leveraging Competitive Elution
- Cell Lysis and Pre-Clearing: Lyse cells in a suitable buffer (e.g., NP-40 or RIPA), pre-clear lysates with control beads to reduce non-specific binding.
- Binding and Washing: Incubate lysates with Anti-HA Magnetic Beads or agarose-conjugated anti-HA antibodies to capture HA-tagged proteins and protein complexes. Wash beads thoroughly to remove contaminants.
- Competitive Elution: Add HA peptide (0.5–2 mg/mL in PBS or TBS) directly to the bead–protein complex. Incubate at 4°C for 30–60 minutes. The HA tag peptide competitively binds the anti-HA antibody, releasing the intact HA fusion protein and associated partners for downstream analysis.
- Quantification and Quality Control: Analyze eluates by SDS-PAGE, silver staining, or mass spectrometry. High peptide purity and solubility ensure minimal carryover and background.
3. Enhancing Protein–Protein Interaction Studies
Using the HA tag in co-IP assays enables detailed mapping of protein–protein interaction networks. For example, in mechanistic studies of E3 ubiquitin ligase function and substrate identification, the HA tag facilitates the capture and release of dynamic complexes, as highlighted in the recent study on NEDD4L-mediated regulation of PRMT5. Here, the HA tag enabled high-fidelity immunoprecipitation and subsequent analysis of E3 ligase–substrate interactions pivotal in colorectal cancer metastasis research.
Advanced Applications and Comparative Advantages
Beyond Conventional Detection: Expanding the HA Peptide Utility
The Influenza Hemagglutinin (HA) Peptide is not just a standard epitope tag for protein detection—it is a cornerstone for next-generation molecular biology and cancer signaling research. Its optimized properties enable several advanced applications:
- Ubiquitination and Degradation Pathway Analysis: The HA tag supports robust co-IP and competitive elution in studies dissecting ubiquitin–proteasome system dynamics, as recently demonstrated in advanced E3 ligase screens (complementary analysis).
- Quantitative Interaction Mapping: High solubility and purity facilitate quantitative mass spectrometry of interaction partners, minimizing peptide interference and maximizing reproducibility.
- AKT/mTOR Signaling Investigation: The peptide is instrumental in studies of post-translational modifications within cancer models, such as the mapping of PRMT5 substrates and AKT1 methylation (see extension of mechanistic insights).
- Multiplexed Assays and Cross-Species Applications: The HA tag sequence is functionally conserved across eukaryotic systems, supporting high-throughput screens and multi-protein complex analyses.
Compared to larger tags (e.g., FLAG, Myc, or GFP), the HA tag's minimal size reduces steric hindrance and cross-reactivity, while its unique sequence ensures specificity in competitive elution workflows. Its integration into advanced workflows complements insights from studies like those found in critical applications in ubiquitination research, underscoring the HA peptide's value in mechanistic protein interaction studies.
Troubleshooting and Optimization Tips: Maximizing HA Tag Performance
- Peptide Solubility: Always dissolve the HA peptide in DMSO, ethanol, or water based on the required concentration. For challenging buffers, pre-dilute in a compatible solvent before adding to aqueous solutions. Use freshly prepared solutions to avoid degradation.
- Elution Efficiency: If recovery is suboptimal, increase peptide concentration incrementally (up to 5 mg/mL), extend incubation time, or perform elution at room temperature for enhanced dissociation.
- Background Reduction: Include stringent wash steps (high-salt and detergent washes) before elution. Pre-clearing lysates against control beads further minimizes non-specific binding.
- Antibody Compatibility: Confirm anti-HA antibody affinity and functionality, especially when switching between magnetic beads and agarose formats. Some monoclonal antibodies may require higher peptide concentrations for effective competition.
- Storage and Stability: Store the lyophilized peptide at -20°C in a desiccated environment for long-term integrity. Avoid repeated freeze–thaw cycles and prepare aliquots as needed. Long-term storage of peptide solutions is not recommended.
- Cross-Reactivity Checks: Validate the specificity of anti-HA antibodies in your system, particularly in multiplexed or cross-species assays, to prevent signal misinterpretation.
For more troubleshooting strategies and optimization case studies, consult comprehensive guides like this in-depth analysis on competitive elution workflows.
Future Outlook: Unlocking New Frontiers in Protein Tagging
The Influenza Hemagglutinin (HA) Peptide is at the forefront of innovation in protein–protein interaction studies, signaling pathway dissection, and cancer biology. With the rise of multi-omics analyses and high-content screening, the HA tag is poised for integration with CRISPR-based epitope tagging, single-cell proteomics, and advanced imaging techniques. Its use in competitive binding assays and as an elution peptide is expanding the scope of applications in both academic and translational research settings.
Emerging research, such as the NEDD4L–PRMT5–AKT/mTOR pathway study, exemplifies the HA peptide's potential to facilitate mechanistic discoveries in complex disease models. As protocols evolve, the HA tag's sequence flexibility (including HA tag DNA and nucleotide sequence variants) and compatibility with other molecular biology peptide tags further broaden its utility. With ongoing enhancements in peptide synthesis and antibody engineering, the next generation of HA tag applications will drive even greater sensitivity and throughput in protein detection, purification, and interaction mapping workflows.
For researchers seeking reliability, specificity, and efficiency in molecular workflows, the Influenza Hemagglutinin (HA) Peptide remains the gold standard—empowering new discoveries at the intersection of protein science and disease biology.